circad | circRNAs associated with diseases

circAKT3
Gene	AKT3	Organism	Human
Genome Locus	chr1:243708811-243736350:-	Build	hg19
Disease	Gastric Cancer	ICD-10	Stomach, Malignant neoplasm of unspecified (C16.9)
DBLink	Link to database	PMID	30927924
Experimental Method
Sample Type	Tissue and cell lines	Comparison	149 GC tissue and controls
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TCCAAATAAACGCCTTGGTGG Reverse CCTCAGAGAACACCCGCTCT	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Huang, X, Li, Z, Zhang, Q, Wang, W, Li, B, Wang, L, Xu, Z, Zeng, A, Zhang, X, Zhang, X, He, Z, Li, Q, Sun, G, Wang, S, Li, Q, Wang, L, Zhang, L, Xu, H, Xu, Z (2019). Circular RNA AKT3 upregulates PIK3R1 to enhance cisplatin resistance in gastric cancer via miR-198 suppression. Mol. Cancer, 18, 1:71.